Scientists have discovered hidden annotations in DNA code left by God and it will terrify you Source: www.reddit.com

// nipples on men; don't work, bugs out if deleted. fix later.

CGATCGACTGCGCTATAGCGATCG

- okaysureee

When bad frontends renovate houses

Submitted By: admin on June 14, 2018

5

0

2016

When bad frontends renovate houses Source: www.reddit.com

css irl

401: Unauthorized

Submitted By: admin on June 16, 2018

5

0

1142

401: Unauthorized Source: www.reddit.com

Fucking hate it when this happens...

the world will be a safer place now

Submitted By: admin on June 14, 2018

4

0

1059

the world will be a safer place now Source: www.reddit.com

This sounds like something Europe would do.

- deanbrown404

Java?

Submitted By: admin on June 15, 2018

4

0

871

Java? Source: www.reddit.com

new AbstractProxyVehicleFactorySingleton().buildCadillac()

- eyekwah2

Microsoft is using AI to make Windows 10 updates smoother

Submitted By: admin on June 16, 2018

4

0

1472

Microsoft is using AI to make Windows 10 updates smoother Source: www.reddit.com

They used coding and algorithms to detect when you’re working.

- The_Perge

That's not AI.

Submitted By: admin on June 11, 2018

6

0

221

That's not AI. Source: twitter.com

Everything is if statements if you dig down far enough.

- resueman__

F*ck Microsoft they said!

Submitted By: admin on June 14, 2018

3

0

3134

F*ck Microsoft they said! Source: www.reddit.com
I had this Conversation with a Friend (who's learning Python at the moment) Source: www.reddit.com

IndexError: list index out of range

When you give up and let the customer decide what the application does and blindly agree to every request Source: www.reddit.com

"Just make a new application for each feature so that it won't clash with each other"

Optimization

Submitted By: admin on June 16, 2018

3

0

297

Optimization Source: www.reddit.com

that's Electron for ya

- jokullmusic

Vim Ransomware?

Submitted By: admin on June 17, 2018

3

0

1128

Vim Ransomware? Source: www.reddit.com

I thought Linux didn't have any viruses? Today I tried updating my Arch laptop but accidentally slipped and ran "vim" instead, which caused my system to open a ransomware. I cannot exit it anymore but it also doesn't give me an address to pay my bitcoin to.

Help me please.

[monkeyuser] root cause

Submitted By: admin on June 13, 2018

2

0

1797

[monkeyuser] root cause Source: www.monkeyuser.com

M$ acquired GitHub

Submitted By: nohttps on June 12, 2018

7

0

1041

M$ acquired GitHub Source: facebook

Visual Studio in a nutshell

Submitted By: admin on June 11, 2018

4

0

744

Visual Studio in a nutshell Source: www.reddit.com

Usually it's a 'THIS VARIABLE ISNT USED, SO SAD. CAN WE GET 1 REFRENCE'

- wafflinggeoduck

But I'm here FROM GOOGLE!

Submitted By: admin on June 14, 2018

2

0

1018

But I'm here FROM GOOGLE! Source: www.reddit.com

stackoverflow

Every Time in maths lesson xD

Submitted By: MisterBoolean on June 11, 2018

5

0

197

Every Time in maths lesson xD

What is #IOT?

Submitted By: Anonymous on October 21, 2015

4

0

1933

What is #IOT? Source: twitter.com
if you ever code something that "feels like a hack but it works," Source: twitter.com

"not to oversimplify: first you have to flatten the rock and put lightning inside it" 

Working as PHP developer

Submitted By: admin on June 29, 2017

10

0

7744

Working as PHP developer Source: www.reddit.com

TFW your workplace is tagged Not Safe For Work.

- SteveCCL

Unfinished projects

Submitted By: admin on June 17, 2018

1

0

869

Unfinished projects Source: www.reddit.com

It is just true

I don't know what I expected

Submitted By: Anonymous on June 3, 2016

4

0

1818

I don't know what I expected Source: www.reddit.com

echo --help

When you write bad code that works

Submitted By: admin on March 20, 2017

11

0

4398

...

Source: www.reddit.com

the game is Poly Bridge

Nice try, Alex.

Submitted By: Florin on March 23, 2017

5

0

3653

Nice try, Alex. Source: www.reddit.com

thats a lot of people called Alex

Multitasking

Submitted By: admin on April 3, 2017

5

0

27022

Multitasking Source: www.instagram.com

Multitasking

Forever jQuery

Submitted By: admin on April 8, 2017

3

0

2247

Forever jQuery Source: www.reddit.com

If you were him, then...?

Submitted By: admin on April 10, 2017

2

0

1021

If you were him, then...? Source: stackoverflow.com

Load More