M$ acquired GitHub

Submitted By: nohttps on June 12, 2018

7

0

1041

M$ acquired GitHub Source: facebook

[commitstrip] Reading an article on your phone in 2018

Submitted By: admin on May 21, 2018

6

0

1275

[commitstrip] Reading an article on your phone in 2018 Source: www.commitstrip.com

Out cookie policy

Today I finally started working on my startup idea. My progress after 6 hours. No joke. Source: www.reddit.com

Looks like you’re ready to do an ICO!

- michaelflux

C++ is a beautiful language

Submitted By: admin on June 2, 2018

6

0

950

C++ is a beautiful language Source: twitter.com

error C2664: 'void std::vector<block,std::allocator<_Ty>>::push_back(const block &)': cannot convert argument 1 from 'std::_Vector_iterator<std::_Vector_val<std::_Simple_types<block>>>' to 'block &&'

That's not AI.

Submitted By: admin on June 11, 2018

6

0

221

That's not AI. Source: twitter.com

Everything is if statements if you dig down far enough.

- resueman__

Programming in 2018

Submitted By: admin on May 21, 2018

5

0

1040

Programming in 2018 Source: www.reddit.com

So I’m gonna build a house and I’m not gonna use a crane to lift things. I’ll do it by hand with rope and pulleys , cause who needs cranes that’s for people who don’t know anything.

- td__30

Stack overflow in a nutshell

Submitted By: admin on May 22, 2018

5

0

879

Stack overflow in a nutshell Source: imgur.com

duplicate?

Imagine being able to wield such a power...

Submitted By: admin on May 24, 2018

5

0

744

Imagine being able to wield such a power... Source: www.reddit.com

"It compiled. Why isn't it working?" "Not sure. There aren't any error messages."

- bnay66

this

Submitted By: admin on May 31, 2018

5

0

640

this Source: twitter.com

JavaScript makes me want to flip the table and say “Fuck this shit”, but I can never be sure what “this” refers to.

Redditor explains how TIME’s drones don’t crash

Submitted By: admin on June 6, 2018

5

0

626

Redditor explains how TIME’s drones don’t crash Source: www.reddit.com

comparing with 1. What is wrong with that guy?

- AyrA_ch

Every Time in maths lesson xD

Submitted By: MisterBoolean on June 11, 2018

5

0

197

Every Time in maths lesson xD
Scientists have discovered hidden annotations in DNA code left by God and it will terrify you Source: www.reddit.com

// nipples on men; don't work, bugs out if deleted. fix later.

CGATCGACTGCGCTATAGCGATCG

- okaysureee

When bad frontends renovate houses

Submitted By: admin on June 14, 2018

5

0

2016

When bad frontends renovate houses Source: www.reddit.com

css irl

401: Unauthorized

Submitted By: admin on June 16, 2018

5

0

1142

401: Unauthorized Source: www.reddit.com

Fucking hate it when this happens...

Well, JavaScript

Submitted By: admin on May 21, 2018

4

0

2692

Well, JavaScript Source: www.reddit.com

At college we were put in a web dev project with literally zero experience in the languages used (php and Javascript iirc), there was so much confusion before people realized this! (we had almost exclusively worked in c++ and java until then)

- zywrek

Project estimates

Submitted By: admin on May 26, 2018

4

0

347

Project estimates Source: www.reddit.com

When you moan about it being cold....

Submitted By: admin on May 24, 2018

4

0

2583

When you moan about it being cold.... Source: www.reddit.com

PC running Java: To warm your house

- Jmcgee1125

What happens after you push corn onto the stack?

Submitted By: admin on May 29, 2018

4

0

552

What happens after you push corn onto the stack? Source: www.reddit.com

Removing the top element of a stack is called popping the element.

- Shadow_Thief

would you call yourself a hard worker?

Submitted By: admin on May 31, 2018

4

0

592

would you call yourself a hard worker? Source: twitter.com

absolutely. I make almost everything harder than it has to be.

By the time you're 35...

Submitted By: admin on June 1, 2018

4

0

1437

By the time you're 35... Source: twitter.com

you should have successfully vertically centred a div at least once.

The Internet is there to help!

Submitted By: admin on June 3, 2018

4

0

829

The Internet is there to help! Source: www.reddit.com

Goddamn stackoverflow, I would say bad things about them if my livelyhood would not depend on them....

- the_monkey_of_lies

Pro programming

Submitted By: admin on June 3, 2018

4

0

958

Pro programming Source: www.reddit.com

'My code finally (barely) works! Time to start adding features...'

- lonesentinel19

Two kinds of developers

Submitted By: admin on June 3, 2018

4

0

1452

Two kinds of developers Source: www.reddit.com

Developer C: What you really need is not a bridge, but a bridge generator! Once it’s finished it can generate unlimited bridges of various designs. More than a billion configurable parameters provide the flexibility to meet any requirement imaginable. The cost of time and money to finish it is only a million times of building a single bridge, quite reasonable considering its limitless potential.

- sunnydavis

Debugging on release day

Submitted By: admin on June 5, 2018

4

0

933

Debugging on release day Source: www.reddit.com

this happens everytime

Everything will be just fine!

Submitted By: admin on June 6, 2018

4

0

586

Everything will be just fine! Source: www.reddit.com

My code is simple. It works, or it doesn't. Put it in a box, then it becomes uncertain.

- lightwhite

IntelliJ has no chill with these passive-aggressive warnings Source: www.reddit.com

I’ll probably get down voted, but first off, that’s awesome. I laughed at it.

Honestly, pretty much any seasoned Java developer will tell you the same thing. IntelliJ is trying to help you save face during a code review.

Figure out why you’re having memory issues to feel the need to garbage collect, then give him a fist bump and buy him a beer for helping you grow as a developer.

- BingoDeville

Programmer spotted

Submitted By: admin on June 8, 2018

4

0

2262

Programmer spotted Source: www.reddit.com

A programmer was pregnant. Her parents asked whether it was a boy or a girl. She said yes.

- Tomarse

That'll do the trick

Submitted By: admin on June 9, 2018

4

0

717

That'll do the trick Source: www.reddit.com

I work with Xamarin... It does work that way, clean and rebuild solves about 30% of my problems

- Cruces

From or using scratch

Submitted By: admin on June 9, 2018

4

0

692

From or using scratch Source: www.reddit.com

https://scratch.mit.edu/

Microsoft buying Github

Submitted By: admin on June 9, 2018

4

0

1457

Microsoft buying Github Source: www.reddit.com

But if I wanted Microsoft to be able to see my source code I would've posted it publicly on the internet, not posted it publicly on the internet!!

Oh, wait.

- Runiat

Load More