Thanks Brendan for giving us the Javascript

Submitted By: admin on June 22, 2018

9

0

5983

Thanks Brendan for giving us the Javascript Source: www.reddit.com

JavaScript has a very interesting type system

- Bill_Morgan

When you mistype x = obj.fiedl...

Submitted By: admin on April 26, 2018

9

0

4062

When you mistype x = obj.fiedl... Source: www.reddit.com

Pycharm is life.

- jeffsterlive

Drinking game for web devs

Submitted By: admin on April 26, 2018

9

1

1486

Drinking game for web devs Source: twitter.com

(1) Think of a noun

(2) Google "<noun>.js"

(3) If a library with that name exists - drink

Made my first big contribution to open source software today

Submitted By: admin on April 29, 2018

8

0

1756

Made my first big contribution to open source software today Source: www.reddit.com

You should submit another PR to correct "Theres" to "There's". And another to correct "rhobust" to "robust".

These contributions absolutely count as street cred.`

- brokedown

When you are learning a new framework and keep closing the tab because "you got it". Source: extrafabulouscomics.com

Learning? You mean after using it for years, right?

- Relixed_

ROCKSTAR DEVELOPER!!!

Submitted By: admin on July 29, 2018

8

0

1737

ROCKSTAR DEVELOPER!!! Source: www.reddit.com

This was a comment here but I felt it needed its own post

visualStudio_irl

Submitted By: admin on May 17, 2018

8

0

1179

visualStudio_irl Source: www.reddit.com

I got Norton for free though my job. Uninstalled it about an hour later because of this.

- luridsorcerer

Guys I found this brilliant tool!

Submitted By: admin on June 18, 2018

8

1

2445

Guys I found this brilliant tool! Source: www.reddit.com

If you run it again, it should say it was found in the database

- zw9491

[lightroastcomics] Link’s Final Form v. 2

Submitted By: admin on June 20, 2018

8

0

1638

[lightroastcomics] Link’s Final Form v. 2 Source: lightroastcomics.com

Hyperlink

Google must've gathered enough data on stop signs and storefronts... Source: www.reddit.com

just highlight the whole thing and you’re good

- Sksk3

How to deal with errors

Submitted By: admin on May 1, 2018

7

0

1207

How to deal with errors Source: www.reddit.com

Very very Helpful

AI in a nutshell

Submitted By: admin on July 21, 2018

7

0

1619

AI in a nutshell Source: www.reddit.com

if(LooksLikeHotdog())

    return "Hotdog";

else

    return "Not Hotdog";

- CuddlePirate420

When you're trying to find who broke production

Submitted By: admin on July 25, 2018

7

0

1624

When you're trying to find who broke production Source: www.reddit.com

"He's just standing there... menacingly!"

When is the best time for me to give you a call?

Submitted By: admin on May 15, 2018

7

0

836

When is the best time for me to give you a call? Source: twitter.com

Developer: Some time around 1996 when phone calls were considered normal.

When you try to choose a meaningful variable name

Submitted By: admin on May 18, 2018

7

0

4203

When you try to choose a meaningful variable name Source: www.reddit.com

 just use x

- aquarius_rock_climb

WittyTitleAboutCodeFormatting = true;

Submitted By: admin on August 1, 2018

7

1

850

WittyTitleAboutCodeFormatting = true; Source: www.reddit.com

if (Human.IsBehind.toString().toLower().equals("true")==true)

- DropTableAccounts

Found a job opening that requires 8+ years of Swift experience. Source: twitter.com

Swift is a programming language that came out 3 years ago.

C++ is a beautiful language

Submitted By: admin on June 2, 2018

7

0

1572

C++ is a beautiful language Source: twitter.com

error C2664: 'void std::vector<block,std::allocator<_Ty>>::push_back(const block &)': cannot convert argument 1 from 'std::_Vector_iterator<std::_Vector_val<std::_Simple_types<block>>>' to 'block &&'

M$ acquired GitHub

Submitted By: nohttps on June 12, 2018

7

0

1620

M$ acquired GitHub Source: facebook
Scientists have discovered hidden annotations in DNA code left by God and it will terrify you Source: www.reddit.com

// nipples on men; don't work, bugs out if deleted. fix later.

CGATCGACTGCGCTATAGCGATCG

- okaysureee

When bad frontends renovate houses

Submitted By: admin on June 14, 2018

7

0

3595

When bad frontends renovate houses Source: www.reddit.com

css irl

401: Unauthorized

Submitted By: admin on June 16, 2018

7

0

2014

401: Unauthorized Source: www.reddit.com

Fucking hate it when this happens...

Another array joke

Submitted By: admin on June 22, 2018

7

0

1938

Another array joke Source: www.reddit.com

You can add BASIC to the "Arrays can start wherever" group.

- Kered13

Stackoverflow

Submitted By: Fakedev on October 12, 2018

7

0

937

Stackoverflow Source: xkcd.com

Very deep, touched my soul.

this thread has been archived

Submitted By: admin on July 1, 2018

7

0

1148

this thread has been archived Source: twitter.com

Still slightly better than "NM fixed it".

At least here you know you need to download something.

- Syllellipsis

Every programmer entered this phase, but never passed it.

Submitted By: admin on April 26, 2018

7

0

1050

Every programmer entered this phase, but never passed it. Source: www.reddit.com

But usually you learn from all of them so... Its a win-win situation

- Imreness

What's efficiency?

Submitted By: admin on April 29, 2018

6

0

1721

What's efficiency? Source: www.reddit.com

You forgot your BBQ adapter interface factory.

- ExternalUserError

Dream of a programmer

Submitted By: admin on April 30, 2018

6

0

998

Dream of a programmer Source: www.reddit.com

22k tests in 681 ms? Hmmm...

- evil_burrito

How Debugging Works

Submitted By: admin on October 1, 2014

37

0

4956

...

My username in every service I sign up for now: "undefined"

Submitted By: admin on July 20, 2018

6

1

2141

My username in every service I sign up for now: "undefined" Source: twitter.com

Really test those strict equality checks.

Load More