nohttps

nohttps

223 points

Member since: June 12, 2018

Scientists have discovered hidden annotations in DNA code left by God and it will terrify you Source: www.reddit.com

// nipples on men; don't work, bugs out if deleted. fix later.

CGATCGACTGCGCTATAGCGATCG

- okaysureee

the world will be a safer place now

Submitted By: admin on June 14, 2018

5

0

2135

the world will be a safer place now Source: www.reddit.com

This sounds like something Europe would do.

- deanbrown404

M$ acquired GitHub

Submitted By: nohttps on June 12, 2018

7

0

2153

M$ acquired GitHub Source: facebook

Load More